Journal: Frontiers in Pharmacology

Article Title: NLRC5 Inhibits Inflammation of Secretory Phase Ectopic Endometrial Stromal Cells by Up-Regulating Autophagy in Ovarian Endometriosis

doi: 10.3389/fphar.2020.01281

Figure Lengend Snippet: NLRC5, LC3, Beclin1, p62, IL-6, TNF-α, and β-actin primers for qRT-PCR.

Article Snippet: The primary antibodies recognizing NLRC5 (ab105411, Abcam, Cambridge, MA, USA), LC3 (ab192890, Abcam, Cambridge, MA, USA), Beclin1 (ab207612, Abcam, Cambridge, MA, USA), p62 (18420-1-AP, Proteintech), IL-6 (ab6672, Abcam, Cambridge, MA, USA), TNF-α (ab6671, Abcam, Cambridge, MA, USA), and β-actin (GB12001, Servicebio, Wuhan, China) were used at 1:1,000, 1:1,000, 1:1,000, 1:1,000, 1:1,000, 1:1,000, 1:1,000, and 1:3000, respectively.

Techniques:

Journal: Frontiers in Pharmacology

Article Title: NLRC5 Inhibits Inflammation of Secretory Phase Ectopic Endometrial Stromal Cells by Up-Regulating Autophagy in Ovarian Endometriosis

doi: 10.3389/fphar.2020.01281

Figure Lengend Snippet: The levels of NLRC5, inflammation, and autophagy in ESCs of patients with endometriosis (n = 5) and patients with leiomyoma (n = 5). (A) Representative image of immunofluorescence staining showing human ESCs displayed long-spindle with positively expressing vimentin and negatively expressing keratin. Photographs were taken at magnifications of 400×. (B , C) Representative western blotting and qRT-PCR showing NLRC5, IL-6, and TNF-α were up-regulated in endometriosis ectopic and eutopic ESCs of patients with endometriosis compared to the ESCs of patients with leiomyoma ( ** P < 0.01 vs. leiomyoma ESCs), and the levels of NLRC5, IL-6, and TNF-α in ectopic ESCs were also significantly higher than in the eutopic ESCs ( ## P < 0.01 vs. eutopic ESCs). Autophagy-related molecules LC3 and Beclin1 were down-regulated in ectopic and eutopic ESCs of patients with endometriosis compared to the ESCs of patients with leiomyoma ( ** P < 0.01 vs. leiomyoma ESCs), and the expression of LC3 and Beclin1 in ectopic ESCs was also significantly lower than in the eutopic ESCs ( ## P < 0.01 vs. eutopic ESCs). (D) Representative ELISA showing IL-6 and TNF-α were up-regulated in endometriosis ectopic and eutopic ESCs of patients with endometriosis compared to the ESCs of patients with leiomyoma ( ** P < 0.01 vs. leiomyoma ESCs), and the levels of IL-6 and TNF-α in ectopic ESCs were also significantly higher than in the eutopic ESCs ( ## P < 0.01 vs. eutopic ESCs). The expression levels of mRNA were normalized with respect to β-actin and were calculated using the 2 -ΔΔCt method. The protein expression levels were quantified by Image J software and normalized to β-actin protein levels. The results are represented as the mean ± SEM from at least three independent experiments.

Article Snippet: The primary antibodies recognizing NLRC5 (ab105411, Abcam, Cambridge, MA, USA), LC3 (ab192890, Abcam, Cambridge, MA, USA), Beclin1 (ab207612, Abcam, Cambridge, MA, USA), p62 (18420-1-AP, Proteintech), IL-6 (ab6672, Abcam, Cambridge, MA, USA), TNF-α (ab6671, Abcam, Cambridge, MA, USA), and β-actin (GB12001, Servicebio, Wuhan, China) were used at 1:1,000, 1:1,000, 1:1,000, 1:1,000, 1:1,000, 1:1,000, 1:1,000, and 1:3000, respectively.

Techniques: Immunofluorescence, Staining, Expressing, Western Blot, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Software

Journal: Frontiers in Pharmacology

Article Title: NLRC5 Inhibits Inflammation of Secretory Phase Ectopic Endometrial Stromal Cells by Up-Regulating Autophagy in Ovarian Endometriosis

doi: 10.3389/fphar.2020.01281

Figure Lengend Snippet: Effect of NLRC5 over-expression on autophagy in EESCs (n = 7). (A) Representative image of immunofluorescence staining showing NLRC5 and LC3, Beclin1 are present both in the cytoplasm and nucleus, NLRC5 and LC3, Beclin1 were co-located in the nucleus. Photographs were taken at magnifications of 1600×. (B , C) Representative western blotting and qRT-PCR results showing over-expression of NLRC5 by transfection with NLRC5 plasmid significantly promoted NLRC5, LC3 Beclin1 expressions, and inhibited p62 expression when compared with vector group ( ** P < 0.01 vs. vector group). (D) Representative images showing LC3 staining in EESCs infected with GFP-RFP-LC3 adenovirus, over-expression of NLRC5 by transfection with NLRC5 plasmid significantly promoted yellow puncta when compared with vector group. Photographs were taken at magnifications of 1,600×, quantification of mean yellow puncta of 10–15 cells per condition is shown ( ** P < 0.01 vs. vector group). (E) Representative transmission electron microscopy (TEM) showing over-expression of NLRC5 by transfection with NLRC5 plasmid significantly promoted autophagosomes formation when compared with vector group, autophagosomes were highlighted by red arrows (left scale bar: 1μm; right scale bar: 2μm; ** P < 0.01 vs. vector group). The expression levels of mRNA were normalized with respect to β-actin and were calculated using the 2 -ΔΔCt method. The protein expression levels were quantified by Image J software and normalized to β-actin protein levels. The results are represented as the mean ± SEM from at least three independent experiments.

Article Snippet: The primary antibodies recognizing NLRC5 (ab105411, Abcam, Cambridge, MA, USA), LC3 (ab192890, Abcam, Cambridge, MA, USA), Beclin1 (ab207612, Abcam, Cambridge, MA, USA), p62 (18420-1-AP, Proteintech), IL-6 (ab6672, Abcam, Cambridge, MA, USA), TNF-α (ab6671, Abcam, Cambridge, MA, USA), and β-actin (GB12001, Servicebio, Wuhan, China) were used at 1:1,000, 1:1,000, 1:1,000, 1:1,000, 1:1,000, 1:1,000, 1:1,000, and 1:3000, respectively.

Techniques: Over Expression, Immunofluorescence, Staining, Western Blot, Quantitative RT-PCR, Transfection, Plasmid Preparation, Expressing, Infection, Transmission Assay, Electron Microscopy, Software

Journal: Frontiers in Pharmacology

Article Title: NLRC5 Inhibits Inflammation of Secretory Phase Ectopic Endometrial Stromal Cells by Up-Regulating Autophagy in Ovarian Endometriosis

doi: 10.3389/fphar.2020.01281

Figure Lengend Snippet: Effects of NLRC5 inhibition on autophagy in EESCs (n = 7). (A , B) Representative western blotting and qRT-PCR results showing inhibition of NLRC5 by transfection with siRNA-NLRC5 significantly inhibited NLRC5, LC3 Beclin1 expressions, and promoted p62 expression when compared with those from the scrambled-RNAi group ( ** P < 0.01 vs. scrambled-RNAi group). (C) Representative images showing LC3 staining in EESCs infected with GFP-RFP-LC3 adenovirus; inhibition of NLRC5 by siRNA-NLRC5 transfection significantly inhibited yellow puncta when compared with scrambled-RNAi group. Photographs were taken at magnifications of 1600×, quantification of mean yellow puncta of 10-15 cells per condition is shown ( ** P < 0.01 vs. scrambled-RNAi group). (D) Representative TEM image showing inhibition of NLRC5 by siRNA-NLRC5 transfection significantly inhibited autophagosomes formation when compared with scrambled-RNAi group, autophagosomes were highlighted by red arrows(left scale bar: 1μm; right scale bar: 2μm; ** P < 0.01 vs. scrambled-RNAi group). The expression levels of mRNA were normalized with respect to β-actin and were calculated using the 2 -ΔΔCt method. The protein expression levels were quantified by Image J software and normalized to β-actin protein levels. The results are represented as the mean ± SEM from at least three independent experiments.

Article Snippet: The primary antibodies recognizing NLRC5 (ab105411, Abcam, Cambridge, MA, USA), LC3 (ab192890, Abcam, Cambridge, MA, USA), Beclin1 (ab207612, Abcam, Cambridge, MA, USA), p62 (18420-1-AP, Proteintech), IL-6 (ab6672, Abcam, Cambridge, MA, USA), TNF-α (ab6671, Abcam, Cambridge, MA, USA), and β-actin (GB12001, Servicebio, Wuhan, China) were used at 1:1,000, 1:1,000, 1:1,000, 1:1,000, 1:1,000, 1:1,000, 1:1,000, and 1:3000, respectively.

Techniques: Inhibition, Western Blot, Quantitative RT-PCR, Transfection, Expressing, Staining, Infection, Software

Journal: Experimental neurology

Article Title: Anacardic acid improves neurological deficits in traumatic brain injury by anti-ferroptosis and anti-inflammation.

doi: 10.1016/j.expneurol.2023.114568

Figure Lengend Snippet: Fig. 2. Verification of ferroptosis characteristics after TBI. (A) The ultrastructure of the cortex on day 7 after TBI in mice was captured by transmission electron microscopy. The red arrow indicates mitochondria. (B) Western blot was performed to observe the time course of changes in the expression of iron metabolism-related proteins (Tfr1 and GPX4). (C) The relative densities of each protein were normalized against GAPDH. ImageJ software was used for western blot band quantification. *P < 0.05, **P < 0.01, and ***P < 0.001 vs sham.

Article Snippet: Serum sealing: the tissue was uniformly covered with 3% bovine serum albumin (BSA) (Servicebio, China) in the tissue circle, and closed at room temperature for 30 min. TfR1 monoclonal antibody (1:300, Proteintech, USA) and GPX4 polyclonal antibody (1:1000, Proteintech, USA) were added respectively, and staining was performed by immunohistochemical EnVision method.

Techniques: Transmission Assay, Electron Microscopy, Western Blot, Expressing, Software

Journal: Experimental neurology

Article Title: Anacardic acid improves neurological deficits in traumatic brain injury by anti-ferroptosis and anti-inflammation.

doi: 10.1016/j.expneurol.2023.114568

Figure Lengend Snippet: Fig. 3. AA inhibits TBI-induced ferroptosis. (A-C) Representative western blots indicating the expression changes of TfR1 and GPX4 in the injured cortex in different groups on 24 h after TBI, respectively, with the right bar graphs. GAPDH was used as a loading control. Western blot bands were quantified using ImageJ software. (D-G) Representative images of immuno histochemical staining of TfR1 and GPX4 in the injured cortex. Quantification of TfR1 and GPX4 levels for different models. Scale bar is 100 μm. (H, I) Representative pictures showing the results of iron accumulation in these above groups. Scale bar is 50 μm. *P < 0.05, **P < 0.01, and ***P < 0.001.

Article Snippet: Serum sealing: the tissue was uniformly covered with 3% bovine serum albumin (BSA) (Servicebio, China) in the tissue circle, and closed at room temperature for 30 min. TfR1 monoclonal antibody (1:300, Proteintech, USA) and GPX4 polyclonal antibody (1:1000, Proteintech, USA) were added respectively, and staining was performed by immunohistochemical EnVision method.

Techniques: Western Blot, Expressing, Control, Software, Staining

Journal: Physiological Research

Article Title: The Role of Mdivi-1 in Reducing Mitochondrial Fission via the NF-κB/JNK/SIRT3 Signaling Pathway in Acute Kidney Injury

doi: 10.33549/physiolres.935445

Figure Lengend Snippet: Apoptosis rate of HK-2 cells in each group. ( A, B, D, E ) flow cytometry results in control, Iohexol, Genta, or Cisplatin group. ( C ) value of apoptosis rate. ( F ) bar graph of apoptosis rate.

Article Snippet: The following materials and instruments were used in this study: human renal tubular epithelial cells (HK-2 cells) (Tongpai Biotechnology Co., Ltd., Shanghai, China); Culture medium and reagents included 1640 medium, fetal bovine serum (FBS) and 0.25 % Trypsin-EDTA (GIBCO, USA); Assay kits and compounds included a Cell Counting Kit-8 (CCK8), Cisplatin, Gentamicin, Iohexol (MedChemExpress, USA); Fixatives and detection kits that were used were glutaraldehyde fixative (for electron microscopy, 2.5%), ANNEXIN V-FITC/PI apoptosis detection kit, ultra-sensitive ECL chemiluminescence reagent A and solution B, TWEEN-20 (Solarbio); PCR Reagents: SYBR® Premix Ex TaqTM II (Takara); Mdivi-1, DRP1 inhibitor ab144589 (abcam); electron microscopy fixative (Servicebio, Wuhan, China); Total RNA Extraction Kit and Reverse Transcription Kit (Tsingke Biotech Co., Ltd.); The primer fragments were human SIRT3-F primer fragment GCTCTACACGCAGAACATCG, human SIRT3-R primer fragment AACACAATGTCG-GGCTTCAC, human GAPDH-F primer fragment GGAGTCCACTGGCGTCTTCA, and human GAPDH-R primer fragment GTCATGAGTCCTTCCACGATACC (synthesized by Tsingke Biotech Co., Ltd.); ROS kit, BCA protein assay kit, SDS-PAGE gel preparation kit (Beyotime, Shanghai, China); Antibodies included active+pro Caspase-3 Rabbit mAb, ACTB Rabbit mAb (high dilution), HRP Goat Anti-Rabbit IgG (H+L) (Abclonal), DRP1(D8H5) Rabbit mAb #5391, Phospho-SAPK/JNK (Thr183/Tyr185) (81E11), Rabbit mAb #4668, NRF2 (D1Z9C), XP® Rabbit mAb #12721, SIRT3 Ab-AF5135-100 μl (Affinity); Instruments used were a fluorescence inverted microscope (Carl Zeiss Microscopy GmbH, Axio Scope A1), flow cytometry (BD, January 2007), microplate reader (BioTek, ELX800), PCR gene amplification system (Roche, LightCycler 480), electrophoresis apparatus (PowerPac, DYY-6C), electron microscope sample preparation system (Leica), and a transmission electron microscope (JEOL, JEM-1400PLUS).

Techniques: Flow Cytometry, Control